Sequencing and Fragment Analysis

 

NATA Accredited for Technical Competence logoSample Submission Form

Sample Submission Guidelines

Sequencing Service Client Questions and Answers


NEW, unique in Australia !

check out our read length improvement...we guarantee read length of average 1000Bp (up to 1200Bp)

see example                  



Sanger Sequencing Service at Garvan Molecular Genetics

Being a medium throughput Sanger sequencing service provider we pride ourselves in our special relationships with our clients. Our goal is to help with expertise, advice and friendly service with very competitive prices. We have several modules you can choose from which give you the flexibility to find exactly the service level you need. 

We offer six different capillary sequencing and fragment separation services:

 

Premix PCR product or Plasmid + primer & SEQ


Sequencing DNA concentration table newGive us your premixed sample (PCR product or plasmid mixed with 3.2pmol of primer) and receive the results within 24 hours. This is the cheap and cheerful option.

Please clean your DNA (PCR products via post-PCR clean up kits or plasmids via mini or midi kits) and quantify your DNA via Nanodrop, gel or fluorescent intercalation. The quality of your input DNA has a significant effect on the quality of your results.

Add the amount of input DNA given in the table to the right to exactly 3.2pmol of freshly diluted primer. The volume of the DNA or primer is of no importance as the mix will be dried down.

The best way to submit a few premixed sequence samples to this service is to use 0.2ml 8xstrip tubes. As we will be using these same tubes for the cycle sequencing reaction, please make sure these tubes are tight. These tubes from Interpath Services Pty. Ltd. are known to work (Cat number 3131-00; 0.2mL 8-Strip PCR Tubes with Caps pkt/ 1000; $80.00). If you are sending your premixed samples by Australian post please dry the mix until no liquid is left in a thermocycler or heat block at 80C for ~2 to 10min. Please label your 0.2ml 8xstrip tubes with the numbers 1 to 8 and your name on one of the tubes, the sample names are not needed on the tubes as we will be uploading them from the electronic sheet that you will send us. Therefore, please make sure the labelling of the tubes (1-8, 9-16 etc) corresponds with the labelling on the Sample Submission Form.  Please send this form to our .

Please submit many samples in a 96 well plate. Please use a semi-skirted plate and fill the plate from column to column (A1 to H1, then A2 to H2 etc).

Please find a detailed guidance for sample setup in our Sample Submission Guidelines. For result interpretation and trouble shooting please see our Sequencing Service Client Questions and Answers.

 

Plasmid Mix & SEQ

For this service you can submit your plasmid DNA and nominate a primer from the list below (or send us your primer or its sequence) and we will take over from there. The turnaround time for this service is 48h. We will:

  1. quantify the plasmid DNA and dilute it to the right concentration
  2. dilute the primer to 3.2pmol
  3. mix the primer with the plasmid DNA
  4. perform cycle sequencing and cleanup
  5. perform capillary separation
  6. send you the results

If you do not have a primer and want us to use a common primer, please select a primer from the list below and we will sequence your plasmid DNA with one of these standard primers:

1. SEQ_AOX_3' (Rev)_25mer CATCTCTCAGGCAAATGGCATTCTG
2. SEQ_AOX_5' (For)_24mer TTGCGACTGGTTCCAATTGACAAG
3. SEQ_BGH_Reverse_18mer TAGAAGGCACAGTCGAGG
4. SEQ_CMV_For (-50)_24mer TCAGATCGCCTGGAGACGCCATCC
5. SEQ_CMV_Forward_21mer CGCAAATGGGCGGTAGGCGTG
6. SEQ_M13 rev (distant)_23mer CGTATGTTGTGTGGAATTGTGAG
7. SEQ_M13_For (-20)_16mer GTAAAACGACGGCCAG
8. SEQ_M13_Rev_17mer CAGGAAACAGCTATGAC
9. SEQ_M13_For (-47)_24mer CGCCAGGGTTTTCCCAGTCACGAC
10. SEQ_pA_-120_33mer TGCAATTGTTGTTGTTAACTTGTTTATTGCAGC
11. SEQ_pET_Rev_21mer TTCACTTCTGAGTTCGGCATG
12. SEQ_pET 3'_18mer CTAGTTATTGCTCAGCGG
13. SEQ_pGL_RV_pr3_20mer CTAGCAAAATAGGCTGTCCC
14. SEQ_pGL_pr2_R_23mer CTTTATGTTTTTGGCGTCTTCCA
15. SEQ_puc_U1_24mer GGGGATGTGCTGCAAGGCGATTAA
16. SEQ_puc_U2_24mer CGGGCCTCTTCGCTATTACGCCAG
17. SEQ_revers_A_24mer CGGCTCGTATGTTGTGTGGAATTG
18. SEQ_seq_ori_20mer TTCCGCTTCCTCGCTCACTG
19. SEQ_SP6_19mer GATTTAGGTGACACTATAG
20. SEQ_T3_Promoter_20mer ATTAACCCTCACTAAAGGGA
21. SEQ_T7_20mer TAATACGACTCACTATAGGG
22. SEQ_T7_Terminator_20mer TAGTTATTGCTCAGCGGTGG
23. SEQ_pGEX_For_24mer  GGGCTGGCAAGCCACGTTTGGTG
24. SEQ_pGEX_Rev_24mer  CCGGGAGCTGCATGTGTCAGAGG
25. SEQ_pGAP For_22mer GTCCCTATTTCAATCAATTGAA

 

Alternatively you can just send us the sequence of the primer you want your plasmid DNA sequenced with and we will order the primer for you and once it arrives use it to sequence your samples. The cost of the primer will be charged to your account. Please add 4 working days to the standard processing time for arrival of the primer.

 

PCR Mix & SEQ

Send us the PCR product you are interested in and nominate or send us the primer you want to use for sequencing. We will:

  1. measure the concentration of the PCR product
  2. dilute the primers and mix with the PCR product at the correct concentration
  3. perform cycle sequencing & cleanup
  4. perform capillary separation
  5. send you the results

PCR Setup & SEQ

Send us the DNA sequence you are interested in or define the gene or exon you would like to have sequenced and submit your genomic DNA sample and we will do the rest. The approximate turnaround time for this service is 7 days (due to ordering the primers). We will:

  1. order the primers and perform the PCR
  2. cleanup the PCR product
  3. measure the concentration of the PCR product
  4. dilute the primers and mix with the PCR product at the correct concentration
  5. perform cycle sequencing & cleanup
  6. perform capillary separation
  7. send you the results

 

PCR Design & SEQ

Send us the DNA sequence you are interested in or define the gene or exon you would like to have sequenced and submit your genomic DNA sample and we will do the rest. The approximate turnaround time for this service is 7 days (due to ordering the primers). We will:

  1. look at the gene and design the primers
  2. order the primers and perform the PCR
  3. cleanup the PCR product
  4. measure the concentration of the PCR product
  5. dilute the primers and mix with the PCR product at the correct concentration
  6. perform cycle sequencing & cleanup
  7. perform capillary separation
  8. send you the results

If you have one design and many samples we can quote you a special price, please ask us. We can also extract the DNA for you if you have tissue or blood samples, please see also our DNA extraction service

 

Post Sequencing Services

In addition to our capillary sequencing modules we also offer post sequencing service modules. We analyse your sequencing products for mutations (predictive or confirmatory) and will prepare reports to our findings. For pricing please see our Molecular Genetics Shop webpage.  

 

Fragment Separation with or without size standard

Our fragment analysis service provides both capillary separation and analysis services for fluorescently labelled DNA fragments. For this service you will perform the PCR and send us the PCR product for electrophoresis. We can run your premixed samples (samples + size standard) or you can send us your samples and we add size standard (GS 600 or GS 500, please specify) and perform the fragment analysis run. Our platform can accommodate up to four different coloured fluorescent dyes:

  • 6-FAM
  • VIC
  • NED
  • PET

Therefore, you can use multiple markers to be amplified for one sample. After the PCRs the products can be pooled and run in a single capillary. When multiple markers of the same colour are pooled, it is important to ensure that the fragment size range of markers does not overlap. Results will be sent out via email, please use the Sample Submission Form and send to our  with the billing information and an email address to which the results shall be forwarded.

 

Pricing

For pricing please see our Molecular Genetics Shop webpage.

 

Sample Submission

Please mail the samples via Australia Post to :

Garvan Molecular Genetics 

Level 8 Garvan Institute
384 Victoria Street
Darlinghurst, NSW, 2010

and email your Sample Submission Form to: 

If you want to drop off your samples personally, please place them in room 8.05 in the sample reception fridge on the second shelf into the rack labelled Sample Reception Tray. 

 

Receiving Results

External clients: We will send you your results within 48h after sample reception to your designated email address. We will be sending you two files for each sample. One is a file with the extension .abi and the other is a file with the extension .seq.

Internal clients: You will receive an email which informs you that the results have been placed into a folder with your name on the Pandora Server. You can access these results in connecting your computer to this server. (PC-users: go to “computer” in your "Explorer" window, go to “Map network drive…”, there will be a drop down menu appearing. In the line “folder” type: \\pandora\volumes|GMG_Results and login with your garvan name and password).

Viewing your Sequencing result

To view your sequencing results you can use FinchTV which is a free software provided by Perkin Elmer, please follow this link. Or download from here.

Viewing your Fragment Separation results

To view your fragment separation results you can use the PeakScanner software, which you can access via the Lifetech Website or download from here.