Oligo Ordering
Oligo Order Service at Garvan Molecular Genetics
Only for Garvan and VCCRI researchers we offer a centralized Oligo Order Service for Oligos from IDT, Sigma-Aldrich, or GeneWorks. Please use the Oligo Order Form, adhering to the following instructions:
- The picture below shows you what to select in the Oligo Order Form if you wish to make a standard Oligo order.
- Please delete any 5' or 3' in the sequence of the oligo before you add it to the excel sheet.
- Please use a unique name for each Oligo (Oligo manufacturers will not accept the same name for two Oligos in one order).
- There is a standard charge per Oligo, which we will deduct from your cost code. The standard charge includes delivery fee.
- If you order over 20 Oligos or modifications we calculate your individual costs.
- Ordering occurs each working day
- If you need modifications or cleanups (HPLC or PAGE) please label the oligo clearly with the modification added to the left or right side, for example \5BIO\GTCCTATCTGATCTGTGCAGT or GTCCTATCTGATCTGTGCAGT\3PHOS\
Please email your Oligo Order Form to email address.
In the Primer Order Form you can choose the manufacturer of your Oligos (Geneworks, IDT or Sigma). You can choose whether you wish to receive tubes or 96well plates, and what scale you need for your Oligos (standard is 25nmol). You can also choose modifications or Ultramers or gBlocks.
Please tick the appropriate boxes and fill in your email address so we can notify you when the Oligos have arrived.
Delivery time and urgent orders
IDT Oligos are manufactured in Singapore and take in average 2 working days to arrive, there is no guarantee for a two day arrival though and sometimes (also depending on what hour in the day they were ordered) it may take 3 working days for them to arrive.
Sigma Oligos are manufactured in Sydney (Castle Hills) and they offer a regular Oligo order service with 3 to 4 days delivery time.
GeneWorks Oligos are manufactured in Australia and also offer two turnaround times. The regular service takes 4 working days and the express service will take 1 to 2 days (depending on the time the order is placed).
Please indicate on the Oligo Order Form the urgency of your order and we will order the Express Service (for IDT only), please be aware that there is an extra charge of $20 for Express Service requests.
Pricing
For prices please see our Molecular Genetics Shop webpage.
Pickup of your Oligos
Upon arrival we will notify you with an email (email address you have given in the Oligo Order Form) about the arrival of your Oligos. You can collect these Oligos any time in room 8.05 (Garvan).
The Oligos will be located on our reception table, see picture to the right, there will be a name tag next to your Oligos and the electronic printouts labelled with your name.
