Sequencing and Fragment Analysis
Access to the Online Sample Submission Portal
Online Sample Submission Portal Instructions
Sequencing Service Client Questions and Answers
How to submit samples online video
Accreditation No: 18464 (category S)
Sanger Sequencing Service at Garvan Molecular Genetics
Being a medium throughput Sanger sequencing service provider we pride ourselves in our special relationships with our clients. Our goal is to help with expertise, advice and friendly service with very competitive prices. We have several modules you can choose from which give you the flexibility to find exactly the service level you need.
We offer six different capillary sequencing and fragment separation services:
- Premix PCR product or Plasmid + primer & SEQ (you premix DNA and primer)
- Plasmid Mix & SEQ (we measure the DNA concentration and mix DNA with a primer provided)
- PCR Mix & SEQ (we measure the PCR product, dilute it and sequence it)
- PCR Setup & SEQ (we amplify your genomic DNA, clean up the product and sequence it)
- PCR Design & SEQ (we design primers and amplify your genomic DNA, clean up the product and sequence it)
- Fragment separation with or without size standard (we separate your labelled DNA fragments)
- Post PCR services (analysis of your results)
Premix PCR product or Plasmid + primer & SEQ
Give us your premixed sample (PCR product or plasmid mixed with 3.2pmol of primer) and receive the results within 24 hours. This is the cheap and cheerful option.
Please clean your DNA (PCR products via post-PCR clean up kits or plasmids via mini or midi kits) and quantify your DNA via Nanodrop, gel or fluorescent intercalation. The quality of your input DNA has a significant effect on the quality of your results.
Add the amount of input DNA given in the table to the right to exactly 3.2pmol of freshly diluted primer. The volume of the DNA or primer is of no importance as the mix will be dried down.
The best way to submit a few premixed sequence samples to this service is to use 0.2ml 8xstrip tubes. As we will be using these same tubes for the cycle sequencing reaction, please make sure these tubes are tight. These tubes from Interpath Services Pty. Ltd. are known to work (Cat number 3131-00; 0.2mL 8-Strip PCR Tubes with Caps pkt/ 1000; $80.00). If you are sending your premixed samples by Australian post please dry the mix until no liquid is left in a thermocycler or heat block at 80C for ~2 to 10min. Please label your 0.2ml 8xstrip tubes with the numbers 1 to 8 and your name on one of the tubes, the sample names are not needed on the tubes as we will be uploading them from the electronic sheet that you will send us. Therefore, please make sure the labelling of the tubes (1-8, 9-16 etc) corresponds with the labelling in the online sample submission portal.
Please submit many samples in a 96 well plate. Please use a semi-skirted plate and fill the plate from column to column (A1 to H1, then A2 to H2 etc).
Please find a detailed guidance for sample setup in our Sample Submission Guidelines. For result interpretation and troubleshooting please see our Sequencing Service Client Questions and Answers.
Plasmid Mix & SEQ
For this service you can submit your plasmid DNA and nominate a primer from the list below (or send us your primer or its sequence) and we will take over from there. The turnaround time for this service is 48h. We will:
- quantify the plasmid DNA and dilute it to the right concentration
- dilute the primer to 3.2pmol
- mix the primer with the plasmid DNA
- perform cycle sequencing and cleanup
- perform capillary separation
- send you the results
If you do not have a primer and want us to use a common primer, please select a primer from the list below and we will sequence your plasmid DNA with one of these standard primers:
1.SEQ_M13_For(-47)_24mer |
CGCCAGGGTTTTCCCAGTCACGAC |
2.SEQ_AOX_3'(Rev)_25mer |
CATCTCTCAGGCAAATGGCATTCTG |
3.SEQ_AOX_5'(For)_24mer |
TTGCGACTGGTTCCAATTGACAAG |
4.SEQ_BGH_Reverse_18mer |
TAGAAGGCACAGTCGAGG |
5.SEQ_CMV_For(-50)_24mer |
TCAGATCGCCTGGAGACGCCATCC |
6.SEQ_CMV_Forward_21mer |
CGCAAATGGGCGGTAGGCGTG |
7.SEQ_M13rev(distant)_23mer |
CGTATGTTGTGTGGAATTGTGAG |
8.SEQ_M13_For(-20)_16mer |
GTAAAACGACGGCCAG |
9.SEQ_M13_Rev_17mer |
CAGGAAACAGCTATGAC |
10.SEQ_pA_-120_33mer |
TGCAATTGTTGTTGTTAACTTGTTTATTGCAGC |
11.SEQ_pET_Rev_21mer |
TTCACTTCTGAGTTCGGCATG |
12.SEQ_pGAPFor_22mer |
GTCCCTATTTCAATCAATTGAA |
13.SEQ_pGL_RV_pr3_20mer |
CTAGCAAAATAGGCTGTCCC |
14.SEQ_pGL_pr2_R_23mer |
CTTTATGTTTTTGGCGTCTTCCA |
15.SEQ_puc_U1_24mer |
GGGGATGTGCTGCAAGGCGATTAA |
16.SEQ_puc_U2_24mer |
CGGGCCTCTTCGCTATTACGCCAG |
17.SEQ_revers_A_24mer |
CGGCTCGTATGTTGTGTGGAATTG |
18.SEQ_seq_ori_20mer |
TTCCGCTTCCTCGCTCACTG |
19.SEQ_SP6_19mer |
GATTTAGGTGACACTATAG |
20.SEQ_T3_Promoter_20mer |
ATTAACCCTCACTAAAGGGA |
21.SEQ_T7_20mer |
TAATACGACTCACTATAGGG |
22.SEQ_T7_Terminator_20mer |
TAGTTATTGCTCAGCGGTGG |
23.SEQ_pGEX_For_24mer |
GGGCTGGCAAGCCACGTTTGGTG |
24.SEQ_ pGEX_Rev_24mer |
CCGGGAGCTGCATGTGTCAGAGG |
25.SEQ_pET3'_18mer |
CTAGTTATTGCTCAGCGG |
SS1_RC_F |
AATCCCATCACCATCTTCCA |
SS2_RC_R |
TGGACTCCACGACGTACTCA |
26.SS_M13_F |
TGTAAAACGACGGCCAGT |
27.SS_M13_R |
CAGGAAACAGCTATGACC |
Alternatively, you can just send us the sequence of the primer you want your plasmid DNA sequenced with and we will order the primer for you and once it arrives use it to sequence your samples. The cost of the primer will be charged to your account. Please add 4 working days to the standard processing time for arrival of the primer.
PCR Mix & SEQ
Send us the PCR product you are interested in and nominate or send us the primer you want to use for sequencing. We will:
- measure the concentration of the PCR product
- dilute the primers and mix with the PCR product at the correct concentration
- perform cycle sequencing & cleanup
- perform capillary separation
- send you the results
PCR Setup & SEQ
Send us the DNA sequence you are interested in or define the gene or exon you would like to have sequenced and submit your genomic DNA sample and we will do the rest. The approximate turnaround time for this service is 7 days (due to ordering the primers). We will:
- order the primers and perform the PCR
- cleanup the PCR product
- measure the concentration of the PCR product
- dilute the primers and mix with the PCR product at the correct concentration
- perform cycle sequencing & cleanup
- perform capillary separation
- send you the results
PCR Design & SEQ
Send us the DNA sequence you are interested in or define the gene or exon you would like to have sequenced and submit your genomic DNA sample and we will do the rest. The approximate turnaround time for this service is 7 days (due to ordering the primers). We will:
- look at the gene and design the primers
- order the primers and perform the PCR
- cleanup the PCR product
- measure the concentration of the PCR product
- dilute the primers and mix with the PCR product at the correct concentration
- perform cycle sequencing & cleanup
- perform capillary separation
- send you the results
If you have one design and many samples we can quote you a special price, please ask us. We can also extract the DNA for you if you have tissue or blood samples, please see also our DNA extraction service.
Research Diagnostic Technical Sanger Sequencing Report (Confirmatory, level 1, ISO 17025)
Our sequencing facility is NATA ISO 17025 accredited to perform Sanger Sequencing for confirmation of defined mutations or polymorphisms or detecting heterozygous loci. We can only perform confirmatory sequencing which means the results must have been generated by whole genome or exome sequencing or microarray analysis before the samples are submitted to our service. We will then extract DNA from patient blood, design PCR primers, amplify the DNA, set up Bigdye reaction, perform capillary separation and analyse the results. We will issue a technical report which can be used for research purposes only.
Post Sequencing Services
In addition to our capillary sequencing modules we also offer post sequencing service modules. We analyse your sequencing products for mutations (predictive or confirmatory) and will prepare reports to our findings. For pricing please see our Molecular Genetics Shop webpage.
Fragment Separation with or without size standard
Our fragment analysis service provides both capillary separation and analysis services for fluorescently labelled DNA fragments. For this service you will perform the PCR and send us the PCR product for electrophoresis. We can run your premixed samples (samples + size standard) or you can send us your samples and we add size standard (GS 600 or GS 500, please specify) and perform the fragment analysis run. Our platform can accommodate up to four different coloured fluorescent dyes:
- 6-FAM
- VIC
- NED
- PET
Therefore, you can use multiple markers to be amplified for one sample. After the PCRs the products can be pooled and run in a single capillary. When multiple markers of the same colour are pooled, it is important to ensure that the fragment size range of markers does not overlap.
Pricing
For pricing please see our Molecular Genetics Shop webpage.
Sample Submission
Please use our online portal (Access to the Online Sample Submission Portal) to submit samples and then send your samples via Australia Post to :
Garvan Molecular Genetics
Level 8 Garvan Institute
384 Victoria Street
Darlinghurst, NSW, 2010
If you want to drop off your samples personally, please place them opposite room 8.05 in the sample reception fridge (placed in the corridor opposite room 8.05) on the second shelf into the rack labelled Sample Reception Tray.
Receiving Results
All results can be downloaded from our online sample submission portal. We will send out an email to your dedicated email address once sample processing has been completed in the laboratory, please follow the links in this email.
Viewing your Sequencing results
To view your sequencing results you can use FinchTV which is a free software provided by Perkin Elmer, please download from here.
Viewing your Fragment Separation results
To view your fragment separation results you can use the PeakScanner software, which you can access via the Lifetech Website or download from here.