Publication Search

Search for publications by

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene


The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Type Journal
ISBN 0036-8075 (Print)
Authors Morrison, N. A.;Shine, J.;Fragonas, J. C.;Verkest, V.;McMenemy, M. L.;Eisman, J. A. :
Garvan Authors Prof John Shine
Publisher Name SCIENCE
Published Date 1989-01-01 00:00:00
Published Volume 246
Published Issue 4934
Published Pages 1158-61
Status Published In-print